gummibears83 gummibears83

14-05-2020
Mathematics

contestada

A bag contains 10 red marbles and 5 blue marbles. What is the probability of choosing 2 red marbles without replacing the first?

Respuesta :

burgurkingfootlettuc burgurkingfootlettuc

18-05-2020

Answer:

i think 5 percent but dont trust me xDDD

Step-by-step explanation:

Answer Link

Otras preguntas

What is the difference between amplitude and wavelength? aThe distance from the center of the light wave to its high or low point. bThe distance between one h

Is the below sequence DNA or RNA? How do you know? GTTTACAGGCGGCGCAATATCTGATCG

What American ethnic groups took part in the military during world war 2

Please help ASAP! I will mark Brainliest! Please answer CORRECTLY! No guessing!

NEED HELP ASAP!! 3 . Writers should study the work of other authors in terms of vocabulary , style , and sentence to expand ideas during the _____ stage .

Anna runs a 5k in 20 minutes. What is her speed in kilometers per hour?

Describe the morality of the Japanese people and government during the Tokugawa Period.

ALOT OF PEOPLE HAVE DONE THIS QUESTION BUT THEY DID NOT ADD POWERS SO IT DIDN'T WORK (2^8⋅ 5^−5⋅ 19^0)^−2⋅5 to the power of negative 2 over 2 to the power of 3

For a game, the numbers 1 to 15 are written on cards. One card is selected randomly. What is the probability of selecting an even-numbered card?

burning fossil fuels, it makes the Earth colder. What percent of the atmosphere is carbon dioxide? A.4% B.0.4% C.40% D.0.04%