sophiafriend34 sophiafriend34

15-05-2020
Biology

contestada

Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Respuesta :

queenb74 queenb74

15-05-2020

The answer is DNA I know because I know

Answer Link

savitar0291 savitar0291

15-05-2020

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

Answer Link

Otras preguntas

Example of Exclamation

How is inspiration different from motivation? Give an example. Each should be a complete paragraph (3-5 sentences).

¿Cómo podemos hacer la expresión corporal?

an inequality that represents each verbal expression. v is greater than or equal to 5.

See photo for questions.

what are factors may affect in Planning process

A lab technician needs to clean medical instruments that have been exposed to bacteria. which electromagnetic wave would be most useful for this task? infrared

In which area of speaking is socially relevant and research based informative or persuasive speaking most likely to take place? a. speaking in the social scien

(28÷4)+3+6x5 tell accordingly the correct answer will be marked as brainliest answer

How are the processes of asexual reproduction and sexual reproduction different? Select three options O In both processes, all offspring have identical DNA. 0 T