christianbautis christianbautis

01-02-2018
Mathematics

contestada

find the value of y and measure of m<3

find the value of y and measure of mlt3 class=

Respuesta :

tyunnagreenfunc tyunnagreenfunc

01-02-2018

I think it is 97°. If not Sorry that I gave you the wrong answer but I'm pretty sure that's the answer.

Answer Link

Otras preguntas

6³=216. Using exponents, write three expressions whose value is 216. Please help I don't understand.

What is the area of the triangular part of the flag below

What word would be used to describe the North’s economy?

What were the goals of Obama's Deferred Action for Childhood Arrivals (DACA) program? A to provide the Dreamers with a path to citizenship B. to create jobs for

How do you love this equation -0.4x -10>14

2. Find the sum of the first 6 terms of the geometric series. 3+15+75+375+.... (Use the formula Sn = 41(1r") to find Sø) 1-r

How do I use a codon wheel to solve this sequence of DNA? AGTACCCGTTAATTAGTTGCCG

Describe TWO barriers to diffusion that are encountered when new words diffuse and become more popular

5. What did A. Philip Randolph do? O He supported the war effort by selling war bonds. O He ran the Office of War Information (OWI) and worked closely with the

How can I find the answer