biggree biggree
  • 04-09-2015
  • Mathematics
contestada

sami ordered 132 dresses for her store .what is 132 rounded to the nearest ten?

Respuesta :

sydney23 sydney23
  • 04-09-2015
the answer is 130 because if the number in the ones place is 0-4 it stays in the 30s, but if its 5-9 it rounds up to the 40s
Answer Link
Shonny Shonny
  • 04-09-2015
It will become 130. The nearest tenth is 30 because number from 4-0 are rounded down example - 164 = 160. Numbers from 5-9 are rounded up example - 197 = 200
Answer Link

Otras preguntas

Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
what are 2 examples of ionic compound?
what is 15/24 in simplest form
Which is one type of play that Shakespeare wrote? A. histories B. musicals C. passion plays D. burlesques Question Resources
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.
Jimmy pays $2.93 for each gallon of gas. Which table best represents the relationship between g, the number of gallons purchased, and m, the amount he pays for
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
what is the geometric mean between 6 and 20?
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.