Denisemortiz Denisemortiz
  • 03-06-2015
  • Mathematics
contestada

is 5.1 greater than 5.01

Respuesta :

kevingrosman kevingrosman
  • 03-06-2015
yeah, it is 5 and 1/10. and 5.01 is 5 and 1/100. so you are comparing 1/10 to 1/100. 1/10 is larger
Answer Link
Alyssa2147
Alyssa2147 Alyssa2147
  • 03-06-2015
yea it is you can always add a zero to the end
Answer Link

Otras preguntas

In terms of weather, what kind of boundary does the line labeled X represent? A. occluded front B. stationary front C. cold front D. warm front
In which section of his autobiography does Douglass show deep emotion? A.the expression of his affection for other slaves B. the narration of the first few y
Susan ........ (Run) to school because she was late.
solve the simultaneous equation 4x+7y=1 3x+10y=15
What were the driving forces behind the industrial revolution
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
A youth ice hockey game has 3 periods that are each 20 minutes long. Colin plays 12 minutes each period. Which ratio shows Colin's playing time compared to the
Specify, "have" in these proposals is to shock or unstressed? 1) They have not lived here for years. 2) He has a house near the river. 3) Have you finished your
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5