AlYSsa1181 AlYSsa1181
  • 01-05-2017
  • Mathematics
contestada

What is the lateral surface area of a triangular prism

Respuesta :

haileymarienava haileymarienava
  • 03-05-2017
A l = (a+b+c) h you would use this formula to find the lateral surface area of a triangular prisim thats all i can help you with bro.
Answer Link

Otras preguntas

5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
A generator stores electric current. Explain why you agree or disagree with this statement
The sum of three numbers is 84 the second number is 2 times the third the first number is 8 more than the third what are the numbers
What are the qualities of a good topic? How will you ensure the topic you choose is relevant and interesting?
Please help me!!!!!!!!!!!!!!!!!!!!! Arusha draws a rectangular prism that is made up of two connected cubes, each with side length e. The surface area of a cert
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Give a recursive algorithm for finding the sum of the first n odd positive integers.
the temperature of a sample of matter is a measure of the ?
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Dalia has just enough money to buy either 6 pears and 20 oranges or 12 oranges and 11 pears. A pear costs $ 0.80. How much does an Orange cost ?