S2ra7shariomiCat S2ra7shariomiCat
  • 03-03-2017
  • Health
contestada

Why must ground beef cooked to 155 degrees?

Respuesta :

Chantalherrera
Chantalherrera Chantalherrera
  • 03-03-2017
Because you can get sick
Answer Link
averycarreno averycarreno
  • 08-03-2017
Because if you do not cook any meats properly, then you can get many different illnesses from the bacteria on or in the meat.
Answer Link

Otras preguntas

Which of the following is NOT a form of formal debate? A. an argument B. policy debate C. parliamentary debate D. Lincoln-Douglass debate
Please help with math question and please show ALL work. 1....How many solutions does the equation 3x+x+3=2(2x+1)+1 have? 2...How many solutions does the pair
How well did feudalism establish order in the Middle ages?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea
if a star is shown ti be 33.11 trillion killometers away , how many light year would that be
Which is the best description of civil liberties? A. natural rights B. privileges C. rights guaranteed by law D. democratic goals E. trial procedures
What was religion like in Shang China?
according to the United States constitution the president has the power to (A) negotiate treaties (B) amend the constitution (C) impeach members of congress
Did feudalism create a stable form of government?