Turkeyfoot
Turkeyfoot Turkeyfoot
  • 01-02-2017
  • Biology
contestada

What is a particle with two or more atoms joined together

Respuesta :

daniella4979 daniella4979
  • 01-02-2017
a molecule because is a group of atoms bonded together
Answer Link

Otras preguntas

This natural landmark was created by the natural forces of erosion. What is its correct name and location?
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
How did the mountains in Greece contribute to the rise of city-states?
Sophia bought 3 yards of trim to put around a rectangular scarf. She wants the width of the scarf to be a whole number that is at least 6 inches and at most 12
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
Do all your pet's offspring look the same? If no, then explain why they look different.
(3x^2 + 2x -2) + ( -2x^2 + 5x+5) My answer 5x^2 + 7× +7 Am i right