KitsuneShard KitsuneShard

02-11-2021
English

contestada

one paragraph about your/my favourite hobby
(something that isn't sports)

Respuesta :

26dfrazier56 26dfrazier56

02-11-2021

Answer:

my favorite hobby would be play outside or talking with friends.

Answer Link

Otras preguntas

PLZ HELP Translate this segment of RNA into the corresponding amino acids. mRNA: AAAAUUCGGCAUGCCGUUAAUGCCCUCGGGGUGA *Remember to begin with the Start Codon "AU

(Take the=22/7)curved surface area of cylinder with diameter 21cm and height 5cm.

26x + 13y = 39 . Rearrange this equation so it is in the form y = mx + b After you have rearranged the equation, identify the slope and the y-intercept. If x =

In which of these two states of matter is water the least dense: solid or liquid?

How was the law of conservation of mass discovered

Write a decimal between each of these decimals.

Printing signs costs $28 for the design plates plus $2 per sign. Which equation correctly describes the cost, c, of s signs? A) 2c = 8 + 28 B) c = 2s + 28 C) 2

Write the dimensions of a rectangular prism or cube and find the surface area. Explain. PLEASE HELP ASAP THANKS SO MUCH

x=[ ? 1° I need help please I don’t know what to do for this someone please help me

What is trivial? Please help it’s for english