91239549 91239549

01-11-2021
Chemistry

contestada

What happes to the number of protons in the nucleus as you go across a period

Respuesta :

bekanwar bekanwar

01-11-2021

They will reduce because I don’t know the answer

Answer Link

Otras preguntas

What can be inferred about the Cyclops in this excerpt from Homer’s Odyssey? The land of Cyclops first, a savage kind, Nor tamed by manners, nor by laws confine

why is the inner mitochondrial membrane folded

What do the tympanic membranes do for the frog?

In a standard normal curve, what percentile corresponds to a z-score of 2.0?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Brainliest!!!!!!!! Which person might most rely on implied meanings when they speak or write A) government official writing a report B) judge delivering a

Quinn is determining the area of a trapezoid. His work is shown below. mc012-1.jpg Step 1: Break the figure into rectangles and triangles. mc012-2.jpg Step

Find the number. Six times a number is 9 more than three times the number. The number is |___| What I’m thinking right now “6x=27”

The non-proliferation treaty attempts to prevent the spread of __________ weapons.

I'm not sure how to do this I was not there that day they taught this and idk what some are and it was yesterday so..