justrock20244 justrock20244
  • 03-09-2021
  • Biology
contestada

brainly if you get the question right

brainly if you get the question right class=
brainly if you get the question right class=

Respuesta :

fatemahtuzahra7
fatemahtuzahra7 fatemahtuzahra7
  • 10-09-2021

Answer:

Youngest ages are at the middle of the pattern (on the oceanic ridges) and the seafloor grows older moving outwards to each side of the middle. 4. Africa and South America used to be joined together in Pangea, but are now separated by the Atlantic Ocean

Answer Link

Otras preguntas

Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l
The type and age of rocks found in the mountain range are also found on another continent. What might this mean?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Give a recursive algorithm for finding the sum of the first n odd positive integers.
What property is shown by the equation? 1. 0 ÷ (–6) = 0
There are 23 tables in the library. Each table has 4 chairs. Third grader fill the chairs at 3 tables. Fourth graders fill the chairs at 6 tables. The rest of t
who fought against each other in the crusades?
testosterone directly affects the
5. On average, how many years earlier do smokers die than nonsmokers? (Points : 1) 5 to 6 10 to 11 13 to 14 19 to 20
How do you put allele in a sentence