Seudónimo Seudónimo

02-08-2021
Mathematics

contestada

The cost of wire sold by the Thor Company is shown in the graph. What is the cost of wire per foot?

1. $0.20
2. $1.25
3. $4.00
4. $5.00

The cost of wire sold by the Thor Company is shown in the graph What is the cost of wire per foot 1 0202 1253 4004 500 class=

Respuesta :

kalebibanez5 kalebibanez5

02-08-2021

111111101010100110

Step-by-step explanation:

es 125

Answer Link

Otras preguntas

In "no witchcraft for sale," why are the farquars particularly happy when teddy is born?

can you guys help me with this simple math problem ?

What does President Lincoln express he did not want to do?

in 1990, there were 350 cell phone subscribers in the small town of Centerville. The number of subscribers increased by 35% per year after 1990

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

The length of a rectangle is three times its width. If the perimeter of the rectangle is 40ft find it’s area

Many assume that presidents with high __________ are more effective leaders.

Joseph and cleoma, who made the first cajun recording, were husband and wife

Solve the given inequality and graph the solution on a number line. I need it on a graph -x/2 +3/2 <5/2

What is the domain of the this function?