ac06230812345
ac06230812345 ac06230812345
  • 04-06-2021
  • Mathematics
contestada

If y - 2x = 3 and y - x = 1, what are the values of x and y?

Respuesta :

Аноним Аноним
  • 04-06-2021

Answer:

x = -2

y = -1

Step-by-step explanation:

y - 2x = 3 and y - x = 1

Subtract the second equation from the first

   y - 2x = 3

- ( y -  x  = 1)

––––––––––

       -x = 2

Multiply both sides by -1

x = -2

Sustitute x = -2 into the first equation

y - 2(-2) = 3

y + 4 = 3

Subtract 4 from both sides

y = -1

Answer Link
batesmonica8 batesmonica8
  • 05-06-2021
Answer above have a nice day
Answer Link

Otras preguntas

Paulina works out with a 2.5 kilogram mass. What is the mass of the 2.5 kilogram mass in grams?
What is the diameter of a circle whose circumference measures 86 26/35? Use pi= 22/7
how to i do 7/16÷(31/2÷1/2)
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
the bombing of Hiroshima and Nagasaki resulted in
How many times does four go into 153 ? What Is the remainder ?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
the temperature of a sample of matter is a measure of the ?
lya took one hour to drive from his apartment to Philips Arena and back. The return drive took 8 minutes less than the trip to the arena. If x represents the ti
the volume of a rectangle prism with square bases is 5880 cubic inches. it has a height of 30 inches. find the side length of the square base.