danielvalencia2005 danielvalencia2005
  • 04-06-2021
  • Medicine
contestada

Do ice baths increase blood flow or slow it down

Respuesta :

madisone64jsjsnsn madisone64jsjsnsn
  • 04-06-2021
reduce blood flow is the answer :)
Answer Link

Otras preguntas

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10
What is 1/5 of 120.00
The equation y minus two-thirds = negative 2 (x minus one-fourth) is written in point-slope form. What is the equation in slope-intercept form?
Help please.Which represents the domain of the following relation? {(-6, 5), (-4, 3), (-1, 0), (4, 3)} *A. 5, 3, 0, 3B. -6, 4, 1, -4C. 6, 4, 1, 4D. –6, -4, -1,
You and six friends go to the movies. Your friend carter collects the money. How much do each of you give carter?
whats 2+2 if you know answer
Which of the following statements best describes the Sherman Act?A. The Sherman Act established the United States Securities and Exchange Commission.B. The Sher
Chang reads 3/4 books in 4/5 hours, what is the unit rate per hour?
Which of the following expressions would not be used to indicate a lack of comprenhension?
What provides comprehensive healthcare for adults and elderly individuals