nyashabutler270 nyashabutler270
  • 03-06-2021
  • Mathematics
contestada

Chose the correct description for the scatter plot below.
O Linear association
O Non-Linear association
No association

Chose the correct description for the scatter plot below O Linear association O NonLinear association No association class=

Respuesta :

Luv2Teach
Luv2Teach Luv2Teach
  • 03-06-2021

Answer:

Step-by-step explanation:

I'm assuming that non-linear means that there is some type of association between the dots, they are just not in a straight line. Now, they definitely are NOT in a straight line, but they do appear to be falling in an exponential pattern. I would say that this is a non-liner association (exponential decay, to be specific).

Answer Link

Otras preguntas

as an allied health worker the single most important thing you can do to prevent the spread of disease is A. take antibiotics B. use antibacterial gel C. wash
How do I factor polynomials by grouping, step by step? 4x^2 - 19x+ 12
Tu as quels cours le jeudi matin?
does a human body use neon???
Do you think then solid can undergo convection
What does hemostasis mean?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
which of these was a result of the treaty of Brest-Litovsk? A. The end of world war 1 B. Russia's withdrawal from the war C. The end of Austria-Hungrays war w
amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
find the prime factorization 504