nae1001 nae1001
  • 04-05-2021
  • Mathematics
contestada

help please and thanks

help please and thanks class=

Respuesta :

grifjin
grifjin grifjin
  • 04-05-2021

Answer:

28km

Step-by-step explanation:

Pythogreom therom

Answer Link
bobqtea bobqtea
  • 04-05-2021

Answer: use p h o t o m a t h

Step-by-step explanation:

Answer Link

Otras preguntas

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
A mixture from which some of the particles settle out slowly upon standing
The word biology means the study of _____. plants animals organisms life
Tick the option that shows how the words 'where my nan lives' are used in the sentence. On holiday, we drove through the village where my nan lives. 1)as a rela
1. Find the missing side length. A. 12 in B. 15 in C. 17 in D. 21 in 2. Find the missing side length. A. 25 m B. 20 m C. 75 m D. 100 m
From fourteenth-century germany, the artist ________ the organic forms of the bodies of mary and jesus in order to express pain and suffering.
Explain the translation process that results in production of a polypeptide
Which expression is a difference? a.(6 - 4) x 5 b.6 - (4 x 5) c.8 + (5 - 2) d.(6 - 4)(3 - 1)?
A mixture from which some of the particles settle out slowly upon standing
a jar contains 6 jellybeans, 4 green jellybeans, and 4 blue jelly beans. if we choose a jellybean, then another without putting the first one back in the jar, w