kimlird kimlird

01-03-2021
Mathematics

contestada

a rectangle measuring 4m by 3m

Respuesta :

jaspreeetsingh jaspreeetsingh

01-03-2021

Answer:

If you are asking the area it is 12

Step-by-step explanation:

Answer Link

rabiasindhu8 rabiasindhu8

01-03-2021

Answer:

Area: 4 x 3 = 12m

Perimeter: 4 + 3 + 4 + 3 = 14m

Step-by-step explanation:

I hope this helps u! :D

Answer Link

Otras preguntas

Caleb solved this equation and recorded his work. 7.4x + 4.1(2x − 4) = −2.3(x − 6) − 21.6 1. 7.4x + 8.2x − 16.4 = −2.3x + 13.8 − 21.6 2. 15.6x − 16.4 = −2.3x

When did christianity become the official religion of the roman empire?

this has me so confused on how you get the answers

A right triangle height of 10cm and a hypotenuse of 26cm what is the b

What did Chinese traders exchange with Islamic merchants?

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

PLEASE HELP ME ASAPPP Identify the base of a triangle in which h = 5 ft and A = (5x + 20) ft2 .

The the flourishing of a vibrant black culture in the 1920s in new york city, called _____, was inspired by countee cullen, langston hughes, and claude mckay.

The vessels that are responsible for carrying blood away from the heart are