khaniyaht
khaniyaht khaniyaht
  • 01-11-2016
  • Mathematics
contestada

y= 60x +34 what is the X

Respuesta :

Аноним Аноним
  • 01-11-2016
The answer is x= -17/30.
Answer Link

Otras preguntas

why are the hindlimbs important on the frog
Write each statement as an algebraic expression. Twice the difference of x and y divided by 5 times their product.
Which of the following is a monomial A. 12c B. C^2 -16 C. c^2+c+6 D. C^3 +4c^2 -12c + 7
CAN SOMEONE HELP ME PLEASE ?
Which of the following are solutions to the equation below? Check all that apply. 4x2 - 81 = 0 A. 9 B.-9/2 C.-2/9 D.-9 E.9/2 F.2/9
a trip to the ocean can be a relaxing escape from the everyday pressures of life. A Sailboat glistening on the horizon provides a mental escape to faraway place
A hat contains three ping-pong balls numbered 1, 2, and 3. kim draws one from the hat. then, without replacing the first ball, she draws another. what is the sa
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
help asap homework due soon 20 pts Read each verbal expression Then assign a variable and distribute
Classify this triangle... sides 4 ,7, 10