brMarymylu brMarymylu
  • 01-11-2016
  • Biology
contestada

In eukaryotes, the components of the electron transport chain are located in the ____.

Respuesta :

antonsandiego
antonsandiego antonsandiego
  • 02-11-2016
Unfortunately you didn't support your question with any options so that I could choose the correct one. But I am pretty sure I've got what you need so in eukaryotes, the components of the electron transport chain are located in the inner mitochondrial membrane.
Answer Link

Otras preguntas

20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
can someone help me solve this and show me the work? it says solve and graph the compound inequality -8<2x+4<10
4.2meters= how many centimeter
Mrs.Henderson had 7/12dozen eggs in her refrigerator.Then she used 1/6 dozen eggs to make a cake.What fraction of a dozen is left?
The rectangle has an area of 4(x+3) square units. A- If the dimensions of the rectangle are doubled, what is the area of the new rectangle in terms of x? Show y
What were the driving forces behind the industrial revolution
A recipe call for 2 cups of water for every 5 cups of flour. How many cups of water are needed for 1 cup of flour? A. 2 1/2 cups B. 2 cups C. 1/2 cup D. 2/5 cup
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do you put allele in a sentence
a woman lifts a 300 newton child a distance of 1.5 meters in 0.75 seconds. What is her power output in lifting the child?