kaymay2
kaymay2 kaymay2
  • 12-09-2016
  • English
contestada

Narcissus could be described as ___. Vain, strong,enchanting, or creative

Respuesta :

michy3 michy3
  • 12-09-2016
Vain. A narcissist is a vain, self entitled person
Answer Link
agustinarivas
agustinarivas agustinarivas
  • 29-05-2019

Answer: Narcissus could be described as "vain".

Explanation: The word "vain" is an adjective used to refer to someone that is too proud of the way in which he/she looks or too proud of what he/she has achieved in life. In that way, "vain" makes reference to someone that has a selfish attitude. In Greek mythology, Narcissus is a character that only cares about himself and his physical appearance; therefore, he can be described as a "vain" character.

Answer Link

Otras preguntas

amy wants to carpet a room that is 12 feet by 8 feet. how many square yards of carpet will she need to complete the room?
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds
which point is in the solution set to the system of inequalities: y>2x-1 and y<1/2x+5
Which is an example of a structural adaptation of a plant? A. plant moving toward light to increase photosynthesis B. roots responding to gravity to get to wa
how do you say theatre in Spanish
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How do you put allele in a sentence
How many years does an apple tree live useful?
p(x) x^3+x^2-x-1 Find all zeros of p (x)
Aiden wrote a riddle: Five less than 1/5 times a number is same as the sum of the number and 1/3. Find the number