trejon9133 trejon9133

14-05-2020
English

contestada

Cuthbert we call him chip is my best friend do we put semicolon or dash

Respuesta :

monicaaac monicaaac

14-05-2020

Answer:

semicolon

Explanation:

Answer Link

Otras preguntas

You invest $500 in an account that has an annual interest rate of 8%, compounded weekly for 12 years. What is the equivalent interest rate and how many times

The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template

You invest $500 in an account that has an annual interest rate of 8%, compounded weekly for 12 years. What is the equivalent interest rate and how many times

On January 1, 20X4, Polar Corp. paid $104,000 for $100,000 par value, 9% bonds of Seal Corp. Seal had issued $300,000 of the 10-year bonds on January 1, 20X2 fo

Read the excerpt from "Harrison Bergeron." He tried to think a little about the ballerinas. They weren’t really very good—no better than anybody else would have

Just before a referendum on a school budget, a local newspaper polls 354 voters to predict whether the budget will pass. Suppose the budget has the support of

In a recent survey, 18 people preferred milk, 29 people preferred coffee, and 13 people preferred juice as their primary drink for breakfast. If a person is sel

Identifying Processes of the Carbon Cycle Quick Check How do consumers obtain the carbon that they need for their life processes? They breathe it in from the su

Which statements are true about British colonialism? Check all that apply. The British Empire was the largest empire in the history of the world. By 1921, the B

Who came to Curly's aid swinging an ax?