AnswersNow11011 AnswersNow11011

14-04-2020
Spanish

contestada

When is number ciento used? Provide two examples:

Respuesta :

Аноним Аноним

14-04-2020

Answer and Explanation:

Ciento veinte= 120

Ciento sesenta= 160

Ciento cuarenta y uno= 141

Hope it helps

Answer Link

df054933 df054933

15-04-2020

ciento uno - 101
ciento cuarenta -140

Answer Link

Otras preguntas

How many amino acids would be included in the polypeptide encoded by the following mRNA S'GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUUUUCAAGAA3 a. 7 b. 8 c. 9 d. 10

Explain what Carl did incorrectly

Zahra, a self-employed, single taxpayer, reports all her income on Schedule C. During the tax interview, her Tax Professional determines that Zahra may qualify

2x+5y=0 X+5y=-10 solve

if you take 2.0mL of a 7.0 ppm NaOH solution and dilute it to 250.0mL, calculate the final concentration in ppm.

Solve a triangle with a = 32. b = 38, and c = 46.A. A = 43.5°: B = 54.8°: C= 81.70B. A = 54.3º: B = 54.8°; C = 81.70C. A = 43.5°: B = 66.5°; C = 81.7D. A = 43.5

I need question number 9

PLEASE HELP Which of the five steps of the decision-making process should have these questions asked ? How could I solve the problem? What are my choices? Who

a 1500kg weather rocket is launched upward from the ground and accelerates at 10m/s it explodes 4s after lifeoff and breaks into two fragments one twice as mass

Suppose your cell phone carrier charges you a monthly fee of $30.00 for up to 300 minutes and $0.45 for each additional minute after the first 300. Assuming y