bree995 bree995
  • 02-07-2019
  • Mathematics
contestada

List all the perfect squares between 1 and 250

Respuesta :

Bryancohen
Bryancohen Bryancohen
  • 10-07-2019

Answer: 1, 4, 9, 16, 25, 36, 49, 64, 81, 100, 121, 144, 169, 196, 225.

Step-by-step explanation:

1 x 1 = 1

2 x 2 = 4

3 x 3 = 9

4 x 4 = 16

5 x 5 = 25

6 x 6 = 36

7 x 7 =49

8 x 8 = 64

9 x 9 = 81

10 x 10 = 100

11 x 11 = 121

12 x 12 = 144

13 x 13 = 169

14 x 14 = 196

15 x 15 = 225

Answer Link

Otras preguntas

Which equation represents the area of one base of a cylinder if the radius is doubled? A. B= = more B. B = 3.72 C. B = 27012 D. B = 4772 Please select the best
The dance committee of Pine Bluff middle school earns $72 from a bake sale and will earn $4 for each ticket they sell to the Spring Fling dance.The dance will c
What is the answer to this question: 39=1 3/10b
state one action that humans could take to slow downrate of global warming.​
Seven times a number plus the sum of three and twice a number is 30.
Mimicry is an resemblance between an organism and another object and they advantages are???
Graph the following: 7. y = x/2 -3
The sum of two numbers is 98. One number is 76 less than the other.
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along this template
What is the constant term in the perfect square that starts with x2-4x