Fortniterlz
Fortniterlz Fortniterlz
  • 02-11-2018
  • Mathematics
contestada

Please help me and explain this.brianliest

Please help me and explain thisbrianliest class=

Respuesta :

omlorissa omlorissa
  • 06-11-2018

the answer is C or the third one.

Answer Link

Otras preguntas

how is the graph of y=9(3)^x+2 +6 translated from the graph of y+9(3)^x
Public opinion in the united states tends to be more _____________ than political elites in areas such as religion in public schools, but more ______________ in
A string of lights contains three lights. the lights are wired in series, so that if any light fails the whole string will go dark. each light has probability .
the mammalian heart has: a. 4 chambers b. 2 chambers c. a two-sided muscular pump d. four-sided muscular pump e. a and c f. b and d
Which hormone is essential to our ability to maintain our fluid levels?
6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat
Differences between body composition- risk for heart disease or chronic disease.
What body systems are used to pick up a pencil and write down a few sentences in the space below? Fingers, Hand and arms is not what I’m looking for.
Dr. shiguli wants to determine the lightest touch that can be felt by various animals compared to human beings. he would therefore be interested in finding the
What value is added to both sides of the equation x2 āˆ’ 2x = 10 in order to solve by completing the square? A. -1 B. -2 C. 1 D. 2