jessenie28 jessenie28

03-10-2018
Mathematics

contestada

Factor the expression completely.

-9.75 + 3.25x

A.
-3.25(3 - x)

B.
-0.25(39 + 13x)

C.
-3.25(6.5 + x)

D.
-0.25(-9.5 - 3x)

Respuesta :

tramserran tramserran

03-10-2018

-9.75 + 3.25x

= -3.25(3) + 3.25(x)

= -3.25(3) - -3.25(x) notice they have the same factor of -3.25

= -3.25(3 - x)

Answer: A

Answer Link

Otras preguntas

How many meters are there in 21 feet?

Somebody asked a teacher: ”How many students do you have? I would like to send my son to your school.” The teacher answered: “If as many students as I have now

Find 8 + 35 + (-76).

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Why was the Neolithic revolution important

What type of plot structure allows authors to follow different characters through their own separate narratives, eventually converging, as the story is resolved

Can someone Help me with that please

Find the product. (7x-2) (x+y)

crystal lattice definition

What will be the value in twenty years of $1000 invested at the end of each year for the next twenty years?