jordansamuels92 jordansamuels92

04-09-2018
Computers and Technology

contestada

Which of these is an aggregator?

1. a browser plugin
2.a widget
3. an RSS reader
4. a utility

Respuesta :

tuckersartainpeiawy tuckersartainpeiawy

04-09-2018

(2) an RSS reader. is a aggregator

Answer Link

christinaogurek christinaogurek

04-09-2018

3. an RSS reader is an aggreagator

Answer Link

Otras preguntas

Help plsssssssssssss

-6.8 + (-12) + (-72.3).

Why is global warming an issue to organisms or speices? How could the high human population growth rate drive further extinctions of plants and animals?

Everfi the person who receives financial protection from a life insurance plan is called a:

if the accuracy in measuring the position of a particle increases, what happens to the accuracy in measuring its velocity?

Find the equation of a line passing through the point (−3, 5) and making an angle of 16° with the x-axis

A federal program that guarantees benefits to qualified recipients is a(n) ________ program

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Which option would best fit in this diagram in the bubble labeled 1?

Which expression is a difference? a.(6 - 4) x 5 b.6 - (4 x 5) c.8 + (5 - 2) d.(6 - 4)(3 - 1)?