Ailyt3358 Ailyt3358
  • 12-04-2024
  • Physics
contestada

A 380 N force is applied horizontally to a 10 kg object initially moving at 5 m/s. Over what displacement must the 380 N force be applied for the 10 kg object?

Respuesta :

Otras preguntas

Explain who or what "Año Viejo" is and its significance.
On Being Brought from Africa to America by Phillis Wheatley 'Twas mercy brought me from my Pagan land, Taught my benighted soul to understand That there's a God
What is the surface area of the prism? A. 144 in2 B. 420 in2 C. 288 in2 D. 140 in2 I really don't know where to post a link to the prism pic
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
an explanation describe if a green pet mates with an orange pet, can they have any orange offspring.
This natural landmark was created by the natural forces of erosion. What is its correct name and location?
what might be learned from an incorrect hypothesis
A tabletop in the shape of a trapezoid has an area of 6,550 square centimeters. Its longer base measures 115 centimeters and the shorter base is 85 centimeters.
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
Why was wilson not able to finish his speaking tour